Nejhorší obavy se naplnily: Pfizer mRNA se přepisuje do DNA

Ve zkratce...

Nová nepříjemná zjištění v souvislosti s mRNA injekcí od Pfizeru. Nová studie zjistila, že mRNA se přepisuje do lidské DNA. Jaké to může mít důsledky? Více se dozvíte v podrobném článku.
Facebook
Telegram
VK

Články publikovány ZDE: 25-28. února 2022

Poznámka redakce:

DNA sekvence uváděná v článku je skutečně sekvence Pfizeru.

Podobnost s gp130 je velmi nepříjemná, neb gp130 je zapojen v signalizačních kaskádách vedoucích k mitogenezi, a od mitogeneze je k rakovinovému nádoru jen krůček.

Mitogenem je peptid nebo malý protein , který indukuje buňky k zahájení buněčného dělení : mitózy . Mitogeneze je indukce (spouštění) mitózy, obvykle prostřednictvím mitogenu. Mechanismus účinku mitogenu spočívá v tom, že spouští cesty přenosu signálu zahrnující mitogenem aktivovanou proteinovou kinázu (MAPK), což vede k mitóze. Mitogen – https://cs.abcdef.wiki/wiki/Mitogen

Pokud se to skutečně i integruje do genomu, tak to je opravdu průšvih, neb fenomén „integračního místa“ je velká věc.

Nelze predikovat, kam se to zaintegruje, a rovněž nikdo neví, kolikrát se to zaintegruje – asi se nebude jednat o jednu integraci, ale spíše o náhodnou a vícečetnou integraci, tak jak to bývá po infekci retroviry.

Odebírejte novinky přímo na email

+ Získáte odkaz ke stažení všech videí. Odhlásit se můžete kdykoliv. Ochrana osobních údajů

Vyšla nová studie: Intracelulární reverzní transkripce mRNA vakcíny BNT162b2 od společnosti Pfizer BioNTech COVID-19 in vitro v buněčné linii lidských jater.

Obsah obrázku text

Popis byl vytvořen automaticky

Článek říká, že laboratorní studie ukazují, že se mRNA vakcína skutečně integruje do lidské buněčné DNA. To znamená, že injekce vakcíny společnosti Pfizer podaná, byť jen jednou, trvale změní DNA postižených buněk.

Nemělo se to stát

Více než rok nám naši důvěryhodní „zdravotničtí experti a ověřovatelé faktů” neustále tvrdili opak:

Obsah obrázku text

Popis byl vytvořen automaticky

Bombastický článek z časopisu Current Issues of Molecular Biology však ukazuje pravý opak.

Článek ukazuje, že in vitro, za použití linie lidských jaterních buněk, vakcína Pfizer mRNA využívá přirozený enzym reverzní transkriptázu zvanou LINE-1 a genetický kód vakcíny je zpětně přepsán do DNA.

Vysvětluje také, že mRNA vakcína skutečně putuje do jater jako do jednoho z preferovaných míst (dalšími místy, jak jsme slyšeli, jsou vaječníky a další).

Co to znamená? Za normálních okolností naše buňky postupují opačně: buněčné jádro, kde se nachází DNA, vyjadřuje určitý kód DNA na základě podmínek v buňce a produkuje přirozenou, lidskou messenger RNA. Tato messenger RNA putuje ven z jádra, kde se exprimuje do proteinů potřebných pro stavbu buňky. Takto rostoucí organismy vyjadřují různé genetické programy pro růst svalových buněk nebo mozkových buněk atd.

Tento proces se nazývá „transkripce”.

Centrální dogma molekulární biologie po mnoho let tvrdilo, že „zpětná transkripce” – přesun genetického kódu z RNA zpět do posvátného buněčného jádra a překódování DNA – je nemožná. Nakonec si vědci uvědomili, že to za různých podmínek možné je. Například virus HIV RNA je toho schopen a přeprogramuje naši DNA tak, aby vytvářela její kopie. HIV je virus, který způsobuje AIDS.

K provedení reverzní transkripce jsou zapotřebí enzymy zvané „reverzní transkriptázy”. Jeden z nich se nazývá LINE-1.

Podle studie zřejmě mRNA vakcína společnosti Pfizer způsobuje, že buňky tento enzym LINE-1 produkují.

Poté, co zaznamenali nárůst reverzní transkriptázy LINE-1, testovali změny DNA, aby se ujistili, že místo ní nezachycují RNA.

Obsah obrázku text

Popis byl vytvořen automaticky

Genetický kód, který zachytili, je:

CGAGGTGGCCAAGAATCTGAACGAGA GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT TCGACGAGGACGATTCTGAGCCCGTGCTGA AGGGCGTGAAACTGCACTACACATGATGAC TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA

Chce na něm někdo spustit BLAST?

Zjednodušeně

Jak jsem vysvětlil v odpovědi na dotaz:

Vakcína Pfizer mRNA mění náš genetický kód, který určuje fungování našich organismů a který jste zdědili po mamince a tatínkovi. Nyní byla vaše DNA změněna oproti tomu, co vám předali máma a táta, přidáním malé záhadné „úpravy” od společnosti Pfizer.

Váš organismus funguje v souladu s programem vaší DNA, a nyní, no, program byl nabourán a upraven společností Pfizer.

Kód rakoviny

Vzhledem k tomu, že Sars-Cov-2 „spike protein” má rakovinový kód z patentu společnosti Moderna z roku 2017 s číslem 9,587,003, je nezbytné zjistit, jaké důsledky má tento zpětný přepis a zda očkovaní nyní nemají ve své DNA zabudovaný nějaký nežádoucí genetický kód.

Zvláště zajímavé je, zda tato reverzní transkripce vyvolaná mRNA ovlivňuje „zárodečnou linii”, jako jsou vajíčka a spermie, a zda ovlivňuje také plod těhotných matek.

Prosím, přeposílejte tento článek dál a dál, protože má velký význam pro naše veřejné zdraví.

EDIT: Náš bystrý komentátor upozornil na anonymní příspěvek na 4chanu z prosince 2020, tedy dlouho předtím, než se o tom začalo vědět. Datum nás všechny nutí se ptát, zda toho ten člověk věděl příliš mnoho?

Obsah obrázku text

Popis byl vytvořen automaticky

Překlad obrázku:

Jsem průmyslový inženýr ve společnosti Moderna a druhý z nás je inženýr pro vývoj procesů. Jsem si jistý, že totéž se děje i ve společnosti Pfizer-BioNTech. Bylo těžké dát věci dohromady na základě malého množství přídavků probíhajících v manuálním kroku (velmi nestandardní pro kontinuální proces výroby). Vysvětlení, které jsme dostali, bylo, že se přidávají vysoce citlivé adjuvanty, které jsou obchodním tajemstvím. Při hlubším pátrání se ukázalo, jak citlivé to ve skutečnosti bylo.

Většina lidí tento nový typ vakcíny chápe tak, že funguje následovně:

1. Vytvořte mRNA kódující protein S

2. Vytvořte lipidový nanočásticový nosič.

3. Zisk

Jak to vlastně funguje z toho, co jsme odhalili:

1. Vytvořte mRNA kódující protein S

2. Vytvořte mRNA kódující mutantní verze CYP19A1 a CDKN1B v menším množství.

3. Ujistěte se, že zatímco doručovací systém pro (1) končí většinou v játrech, většina (2) končí v gonádách.

4. Ujistěte se, že forma a množství přídatné látky zvyšující aktivitu reverzní transkripce LINE-1 ztěžuje její detekci mezi regulérními adjuvanty.

5. Účinky (2) integrované (4) jsou recesivní; mírně onkogenní účinky u příjemců vakcíny pravděpodobně nebudou zaznamenány po mnoho let.

6. (5) recesivní, ale protože většina populace je očkována, v další generaci dochází u potomků ženského pohlaví k předčasnému selhání vaječníků.

(6) se shoduje s tím, že chudí lidé jsou posedlí UI (umělou inteligencí) a robotikou, takže jsme nemuseli pátrat po motivaci.

Přijali jsme preventivní opatření, ale obáváme se o svou bezpečnost. Zatím si nemyslím, že bychom vzbudili podezření, ale jistotu mít nemůžeme. Nejsme si jisti, co dělat. Tím, že se vyhýbáme očkování, z nás dělá hlavní podezřelé z tohoto úniku.

DNA přepsaná z mRNA vakcíny Pfizer obsahuje mutantní nádorový gen gp130 (2. část – pokračování článku)

https://igorchudov.substack.com/p/dna-transcribed-from-pfizer-mrna?s=r

Můj předchozí příspěvek o vědeckém článku dokazujícím, že vakcína Pfizer mRNA se zpětně přepisuje do lidské DNA, vzbudil obrovský zájem a spoustu komentářů, z nichž některé byly neuvěřitelné.

Pokud jste ho ještě nečetli, PŘEČTĚTE SI HO PROSÍM PRVNÍ, než si přečtete toto navazující pokračování. Jinak se můžete ztratit a ani si neuvědomit význam toho, jak mohl být přeprogramován genetický kód vašich blízkých.

Rozhodl jsem se pokračovat v práci a zjistit, co dalšího můžeme objevit na základě článku „Current Issues in Molecular Biology„:

Obsah obrázku text

Popis byl vytvořen automaticky

Článek obsahuje výtisk genetického kódu DNA, který byl zjištěn v materiálech DNA lidských buněk reverzně přepsaných z mRNA vakcíny.

Obsah obrázku text

Popis byl vytvořen automaticky

Tak jsem se rozhodl zkontrolovat, co je vlastně v tomto kódu výše, zda je to jen neškodné smetí, nebo něco zlověstnějšího. Za tímto účelem jsem spustil bezplatný nástroj NCBI „BLAST“ tak, že jsem do něj zkopíroval a vložil výše uvedenou genetickou sekvenci. Jedná se o stejný nástroj BLAST, který použil @JikkyKjj, aby ukázal sekvenci „patentu na rakovinu” od Moderny na nejdůležitější, „furinové štěpné místo” Sars-Cov-2.

Každopádně jsem se pod dojmem objevu @JikkyKjj rozhodl udělat totéž s DNA kódem, který vakcína Pfizer mRNA generuje (reverzně přepisuje) do lidských buněk. Ukázalo se, že jsem jako první zadal tuto sekvenci do nástroje NCBI BLAST (protože její analýza chvíli trvala) a nyní má sekvenční ID 1R3ZDZJY016.

A tady jsou výsledky. Opatřil jsem je poznámkami, abyste snáze viděli, co je a co není zajímavé.

Obsah obrázku text

Popis byl vytvořen automaticky

Prvních několik výsledků pochází od obvyklých podezřelých, jako jsou chimérické viry, sekvence Sars-Cov-2 atd. Je pochopitelné, proč bychom je měli ignorovat – chimérické viry jsou čistě laboratorní konstrukty neznámého významu a sekvence Sars-Cov-2 jsou tam zřejmě proto, že vakcína kóduje protein Sars-Cov-2 spike. To jsou „očekávané shody”.

Co je zajímavé – a netvrdím, že je to jediná věc – je gen pro glykoprotein gp130, který je z 97 % podobný lidskému genu pro glykoprotein gp130. Šance, že se jedná o náhodnou shodu, je podle nástroje BLAST 0,000000000000000000000000000000000000000000000000000000000000000000000002 %

Kliknul jsem na něj:

Obsah obrázku text

Popis byl vytvořen automaticky

Kliknutím na odkaz „Gen” se dozvíte, co je to gen gp130:

Obsah obrázku text

Popis byl vytvořen automaticky

Máme tedy mRNA covid vakcínu od Pfizeru, která se reverzně přepisuje do MUTOVANÉHO genu gp130. Vzpomínáte si na 97% shodu? Ta 3% neshoda, čtyři červené tečky, jsou mutace genu gp130.

Aniž bychom se tedy zabývali těmito konkrétními mutacemi, co se stane, když gen gp130 zmutuje obecně? Nic dobrého se neobjeví a můžete si to také vyhledat.

Obsah obrázku text

Popis byl vytvořen automaticky

Upozorňujeme, že vyvstává otázka: mutace gp130 mohou způsobit nádor jater a celý experiment byl proveden na linii nesmrtelných buněk rakoviny jater. Je možné, že původní článek zachytil mutovanou gp130 z buněk rakoviny jater Huh7? Pokud je tomu tak a sekvence DNA je vlastní samotné linii Huh7, mohlo by to zneplatnit mnoho závěrů, které původní vědecký článek i mé vlastní články dělaly.

Autoři však pečlivě prováděli kontroly a u kontrolních buněk, které NEOBSAHOVALY vakcínu společnosti Pfizer, NEVIDĚLI zpochybňovanou sekvenci DNA, na kterou se dívám já. Kromě toho publikovaná sekvence DNA obsahovala geny Sars-Cov-2 (viz výsledky BLAST), takže skutečně pochází z účinku vakcíny, nikoli z buněk kultury Huh7.

Provedl jsem zběžnou kontrolu podle svých možností a linie Huh7 obsahuje mutace p53, ale nezdá se, že by obsahovala mutace gp130.

Takže držím palce, aby mutovaný gen gp130, který jsem našel, byl skutečným nálezem laboratorního výzkumu, pocházel z mRNA vakcíny, a ne náhodným vyzvednutím z buněk Huh7.

Předpokládám, že autoři zkoumali konkrétně jaterní buňky, protože věděli, kde hledat (že systém doručení mRNA dopraví lipidové nanočástice do jater). Proč si autoři vybrali právě jaterní buňky? Možná proto, že se dozvěděli o tomto příspěvku na 4chanu z roku 2020, kdy se o podivných mRNA vakcínách ještě NIC nevědělo:

Obsah obrázku text

Popis byl vytvořen automaticky

Překlad obrázku:

Jsem průmyslový inženýr ve společnosti Moderna a druhý z nás je inženýr pro vývoj procesů. Jsem si jistý, že totéž se děje i ve společnosti Pfizer-BioNTech. Bylo těžké dát věci dohromady na základě malého množství přídavků probíhajících v manuálním kroku (velmi nestandardní pro kontinuální proces výroby). Vysvětlení, které jsme dostali, bylo, že se přidávají vysoce citlivé adjuvanty, které jsou obchodním tajemstvím. Při hlubším pátrání se ukázalo, jak citlivé to ve skutečnosti bylo.

Většina lidí tento nový typ vakcíny chápe tak, že funguje následovně:

1. Vytvořte mRNA kódující protein S

2. Vytvořte lipidový nanočásticový nosič.

3. Zisk

Jak to vlastně funguje z toho, co jsme odhalili:

1. Vytvořte mRNA kódující protein S

2. Vytvořte mRNA kódující mutantní verze CYP19A1 a CDKN1B v menším množství.

3. Ujistěte se, že zatímco doručovací systém pro (1) končí většinou v játrech, většina (2) končí v gonádách.

4. Ujistěte se, že forma a množství přídatné látky zvyšující aktivitu reverzní transkripce LINE-1 ztěžuje její detekci mezi regulérními adjuvanty.

5. Účinky (2) integrované (4) jsou recesivní; mírně onkogenní účinky u příjemců vakcíny pravděpodobně nebudou zaznamenány po mnoho let.

6. (5) recesivní, ale protože většina populace je očkována, v další generaci dochází u potomků ženského pohlaví k předčasnému selhání vaječníků.

(6) se shoduje s tím, že chudí lidé jsou posedlí UI (umělou inteligencí) a robotikou, takže jsme nemuseli pátrat po motivaci.

Přijali jsme preventivní opatření, ale obáváme se o svou bezpečnost. Zatím si nemyslím, že bychom vzbudili podezření, ale jistotu mít nemůžeme. Nejsme si jisti, co dělat. Tím, že se vyhýbáme očkování, z nás dělá hlavní podezřelé z tohoto úniku.

Bylo nám řečeno, že se to nikdy nestane

Obsah obrázku text

Popis byl vytvořen automaticky

Objasnění

Sekvence mutovaných genů gp130, nalezená v DNA reverzně přepsané z vakcíny Pfizer Covid,

  • neznamená, že NUTNĚ způsobí rakovinu.
  • Čtyři uvedené mutace „červené tečky” mohou být neškodné
  • Neznamená, že byly do vakcíny společnosti Pfizer přidány záměrně, aby způsobily poškození.
  • Neznamená, že je dokonce exprimován jako protein gp130, protože exprese genů závisí na buněčném kontextu.
  • Znamená to však, že se na to musíme podívat zblízka.

Sdílejte prosím tento článek

Prosím, přeposílejte tento článek v naději, že ho uvidí někdo důležitý a úřady se začnou zajímat o „neočekávané” účinky covid mRNA vakcín mRNA. Naše děti ji dostávají injekčně a zasloužíme si vědět, co to s nimi dělá!

Obsah obrázku text

Popis byl vytvořen automaticky

Obsah obrázku text

Popis byl vytvořen automaticky

Obsah obrázku text

Popis byl vytvořen automaticky

 

Tvrzení o genetickém poškození novorozených holčiček lze snadno ověřit (3. část)

https://igorchudov.substack.com/p/allegations-of-genetic-harm-to-newborn?s=r

Nedávno jsem napsal několik článků o studii, která zjistila reverzní přepis mRNA do DNA v lidských buňkách.

Proč je to důležité? Když začala kampaň očkování mRNA, bylo nám slíbeno, že mRNA uzavřená v lipidových nanočásticích (LNP) má velmi krátkou životnost, vytváří „neškodný spike protein” a za několik dní zmizí, čímž připraví náš imunitní systém na úspěch. Virus, jak nám bylo řečeno, „přestane s každým očkovaným člověkem”.

Nyní víme, že nic z toho, co nám bylo slibováno, nebyla pravda: spike protein není neškodný, mRNA z vakcíny je nepřirozeně stabilizovaná a zůstává aktivní po celé měsíce, a samozřejmě víme, jak dobře vakcína funguje. A co je nejhorší, dozvěděli jsme se, že mRNA vakcíny se v lidských buňkách mění na DNA.

Od doby, kdy jsem tyto články zveřejnil, však vyšly najevo mnohem znepokojivější informace. Týkají se „modifikací zárodečné linie”, tedy modifikací ženských vajíček a mužských spermií, které by mohly v příští generaci způsobit neplodnost žen.

Znepokojivá tvrzení

Jeden bystrý čtenář upozornil na archivní kopii anonymního příspěvku z roku 2020, tedy z doby předtím, než se o jakýchkoli problémech s vakcínami začalo vědět. Tento anonymní, nepodepsaný příspěvek na serveru 4chan údajně napsali procesní inženýr společnosti Moderna a průmyslový inženýr společnosti Moderna.

Obsah obrázku text

Popis byl vytvořen automaticky

Překlad obrázku:

Jsem průmyslový inženýr ve společnosti Moderna a druhý z nás je inženýr pro vývoj procesů. Jsem si jistý, že totéž se děje i ve společnosti Pfizer-BioNTech. Bylo těžké dát věci dohromady na základě malého množství přídavků probíhajících v manuálním kroku (velmi nestandardní pro kontinuální proces výroby). Vysvětlení, které jsme dostali, bylo, že se přidávají vysoce citlivé adjuvanty, které jsou obchodním tajemstvím. Při hlubším pátrání se ukázalo, jak citlivé to ve skutečnosti bylo.

Většina lidí tento nový typ vakcíny chápe tak, že funguje následovně:

1. Vytvořte mRNA kódující protein S

2. Vytvořte lipidový nanočásticový nosič.

3. Zisk

Jak to vlastně funguje z toho, co jsme odhalili:

1. Vytvořte mRNA kódující protein S

2. Vytvořte mRNA kódující mutantní verze CYP19A1 a CDKN1B v menším množství.

3. Ujistěte se, že zatímco doručovací systém pro (1) končí většinou v játrech, většina (2) končí v gonádách.

4. Ujistěte se, že forma a množství přídatné látky zvyšující aktivitu reverzní transkripce LINE-1 ztěžuje její detekci mezi regulérními adjuvanty.

5. Účinky (2) integrované (4) jsou recesivní; mírně onkogenní účinky u příjemců vakcíny pravděpodobně nebudou zaznamenány po mnoho let.

6. (5) recesivní, ale protože většina populace je očkována, v další generaci dochází u potomků ženského pohlaví k předčasnému selhání vaječníků.

(6) se shoduje s tím, že chudí lidé jsou posedlí UI (umělou inteligencí) a robotikou, takže jsme nemuseli pátrat po motivaci.

Přijali jsme preventivní opatření, ale obáváme se o svou bezpečnost. Zatím si nemyslím, že bychom vzbudili podezření, ale jistotu mít nemůžeme. Nejsme si jisti, co dělat. Tím, že se vyhýbáme očkování, z nás dělá hlavní podezřelé z tohoto úniku.

Za normálních okolností by si taková anonymní obvinění nezasloužila žádnou pozornost, s výjimkou

  • Tohle bylo vlastně dobře napsáno s použitím správného obchodního žargonu
  • Bylo to napsáno v roce 2020 PŘEDtím, než se začalo cokoli vědět o nebezpečnosti mRNA vakcín, a použité termíny nebyly v kurzu
  • Mnohá tvrzení tohoto příspěvku se skutečně ověřují. Konkrétně LINE-1 reverzní transkriptáza interaguje s vakcínami a reverzní transkripce DNA skutečně převádí mRNA na DNA v lidských buňkách.
  • Tyto věci je velmi těžké vymyslet bez znalosti věci.

Největším tvrzením je, že záměrně mutovaná verze genu CDKN1B končí v gonádách (vaječnících a varlatech). Kromě toho anonymní příspěvek tvrdí, že náklad mRNA by modifikoval lidskou DNA buněk produkujících vajíčka i spermie a vnesl by do ní mutaci CDKN1B. Podle tohoto neověřeného příspěvku bez uvedení zdroje je tato mutace recesivní, což znamená, že by se projevila pouze tehdy, pokud by OBĚ rodičovské pohlavní buňky – vajíčko a konkrétní spermie, která ji oplodní – nesly CDKN1B.

Možným důsledkem této údajné mutace je, že potomci očkovaných osob ženského pohlaví by byli náchylní k „předčasnému selhání vaječníků”, a tudíž by nebyli schopni reprodukce.

Tento typ anonymních materiálů by měl být obvykle odmítnut jako divoká fantazie, AŽ NA TO, ŽE CO PROZATÍM VÍME, POTVRZUJE TO, CO SE V NĚM PÍŠE, a bylo to napsáno dříve, než se široká veřejnost mohla dozvědět jakákoli tato fakta nebo problémy, takže dává smysl, že to napsali zasvěcení lidé, a nejedná se o spekulace nezasvěcených.

Podle mého názoru si tedy tento příspěvek zaslouží další skeptickou, ale pozornou pozornost.

Jak to ověřit nebo (snad) vyvrátit

Je velmi obtížné ověřit v laboratoři, jaké procesy přesně probíhají „in vivo”, uvnitř vaječníků a varlat. Měření takových procesů v reprodukčních orgánech je náchylné k chybám, molekulární složitosti, složitým etickým otázkám a pravděpodobně bude velmi časově náročné a nákladné na řádné studium.

Výsledek toho všeho je však velmi snadné otestovat: stačí najít několik desítek novorozených holčiček, které se narodily rodičům dvakrát očkovaným nejméně měsíc před početím. Pak by jim vědci mohli provést stěr DNA z tváří a ověřit, zda tyto holčičky nesou údajnou mutaci CDKN1B.

Taková studie by nebyla invazivní, přinesla by (snad) rodičům potěšující zprávu a byla by levná.

Když se podíváme na časovou osu, dítě narozené v březnu 2022 by bylo počato přibližně v červnu loňského roku, takže každý pár, kde byli oba manželé očkováni před loňským květnem, by splňoval podmínky. Taková miminka není vůbec těžké najít a mělo by to být velmi snadné provést. Nejedná se o žádné invazivní zákroky a novorozenci nehrozí žádné nebezpečí.

Doufám a modlím se, aby odpověď byla negativní a holčičky nebyly nositelkami mutace CDKN1B. Ale nějaké ujištění bychom určitě uvítali.

Sperma

Dalším velmi snadným pokusem je otestovat sperma očkovaných mužů, zda nevykazuje zvýšenou hladinu nějaké specifické mutace ve srovnání s minulostí.

Překlad obrázku:

Sekvenční analýza genu CDKN1B u pacientek s předčasným
selháním vaječníků odhalila novou mutaci
potenciálně související s fenotypem.

Předčasné selhání vaječníků

Facebook
Telegram
VK

Líbí se Vám překlady?

Jestli jsou pro Vás videa hodnotná a líbí se vám, ocením podporu na chod tohoto projektu. Vím, jak jsou reklamy otravné, proto je zde nechci dávat. Libovolnou částku můžete zaslat na níže uvedené číslo účtu, nebo jednodušeji přes mobilní aplikaci si oskenovat QR kód. Děkuji za Vaši podporu!

Bankovní účet (CZK): 2201583969/2010
Do zprávy příjemce napište prosím: Dar

Pro platby na eurový účet (EUR):
Jméno: David Formánek
IBAN: CZ8520100000002201806894
SWIFT/BIC: FIOBCZPPXXX
Do zprávy příjemce napište prosím: Dar

CZK účet

Náhodný výběr

Diskuze

38 komentářů

    1. Vážený pane Romane. To že jste vědomě navštívil tento web svědčí o tom, že vás tyto informace zajímají. To, že jste reagoval v diskuzi svědčí o tom, že jste zatím tyto informace nepochopil, nebo si je nechcete připustit. Takže bych Vám doporučil získávat informace (máte na to Ústavní právo), ověřovat informace, vyhodnotit informace a poté si udělat názor.

      1. jsem informován nebojte,, vše na těchto stránkách mám ověřené že jsou to dezinformace, a informace si získávám nebojte,, a kde beru informace o Covidu? Řazeno podle relevance:
        1️⃣ Agentury a přední vědecká pracoviště věnující se pandemii – americká CDC, německý Robert Koch Institute, britská NHS, evropská CDC…
        2️⃣ Studie publikované v předních žurnálech (The Lancet, NEJM, JAMA, The British Medical Journal…). V ideálním případě hledat meta-analýzy či systemické přehledy, plus je potřeba dávat si pozor na studie ve stádiu pre-print, které ještě neprošly peer-review.
        3️⃣ Media, které mají silnou vědeckou redakci (The New York Times, BBC, The Economist, The Guardian…. v ČR pak např. Věda24).
        Tyto zdroje také nejsou neomylné, a však pravděpodobnost toho, že se mýlí je výrazně nižší než u čehokoliv jiného.
        Kde naopak informace nebrat?
        1️⃣ Anonymní či neznámé weby, konspirační videa a dezinformační weby, např. server Otevři svou mysl (seznam hlavních dezinfo webů: bit.ly/dezinfo-weby).
        2️⃣ Česká média bez silných vědeckých redakcí, speciálně pak ta, kterým jde primárně o sledovanost / čtenost. Většina redaktorů nemá šanci hostům oponovat ve vědeckých otázkách a následné články neobsahují fack-cheking a dostanou se do nich často nesmysly (bohužel světlých výjimek je málo).
        3️⃣ Zvláště je třeba dávat si pozor na české vědecké autority, které v médiích své názory nepodkládají primárními zdroji. Názory nejsou fakta. Takže pokud má někdo pravdu, tak to nikdy nebývá konkrétní osoba, ale zdroje, ze kterých ta osoba vychází.
        4️⃣ Speciální pozor na server SMIS, který má blízko k Zdravému fóru, které zase často sdílí zprávy z dezinformačního webu Otevři mysl. Jedná se o sofistikovanější verzi dezinformací, často překládáných ze zahraničích anti-vax serverů a často manipulující se zdroji a daty. pane Franto přeji hezký den:)

        1. “ Kde naopak informace nebrat?
          1️⃣ Anonymní či neznámé weby, konspirační videa a dezinformační weby“

          = Vraťte se zpět k té vaší mediální žumpě typu seznam, tv apod., vy ověřovači dezinformací 😀 xD vy jste idiot..

          1. nerozčiluj se ty jedna trumbero,štvětě že jsem tě argumentačně romáčknul jako červa:)

    2. Vážený pane, to tak nenávidíte lidskou svobodu, že se uchylujete k takto odporným výlevům?
      Internet vznikl jako prostor pro svobodné sdílení, aspoň to tak zakladatelé hlásali.
      Možná ti vaši „chlebodárci“ ve které „doufáte“ zakážou tyto stránky. Ve své nenávisti si ale uvědomte,
      že některé první kroky mají své důsledky. A ve svém konci mohou být tyto důsledky hrůzostrašné.
      To si opravdu přejete? Možná, jestli dožijete.. dojde z jejich strany i k „vašemu vypnutí“.

    3. Vážený pane, to tak nenávidíte lidskou svobodu, že se uchylujete k takto odporným výlevům?
      Internet vznikl jako prostor pro svobodné sdílení, aspoň to tak zakladatelé hlásali.
      Možná ti vaši „chlebodárci“ ve které „doufáte“ zakážou tyto stránky. Ve své nenávisti si ale uvědomte,
      že některé první kroky mají své důsledky. A ve svém konci mohou být tyto důsledky hrůzostrašné.
      To si opravdu přejete? Možná, jestli dožijete.. dojde z jejich strany i k „vašemu vypnutí“.

    4. Deziformace. To je populární slovíčko. Jenže důkazy jsou v každém očkovaném člověku. Lež má prostě krátké nohy.

    1. Uvedu ještě další zajímavé fakta a prosím, ignorujte toho trola nademnou, nereagujte na „Roman“ – on jen tak z nudy plácá, uhrovatej a chudej teenager to asi bude…píše nejspíše z mámina počítače a cítí se být velký frajer, když sem něco dodá 🙂

      Podle mého odhadu nám zbývá deset měsíců na boj s digitalizací našich životů – a nástupem Velkého resetu. Nový světový řád klepe na dveře…

      1) Občanům, kterým nebyl vpíchnut jed mRNA, je již ve Velké Británii, USA a dalších zemích odepřena zdravotní péče.
      2) V Kanadě Trudeau předkládá zákon „proti nenávisti“, který umožní lidem preventivně podat žalobu, pokud mají pocit, že uslyší něco nenávistného. Přečtěte si tu větu ještě jednou. K tomu nás dovedli probuzení a politicky korektní šílenci. Lidé v Kanadě budou moci podat žalobu, pokud si budou myslet, že by mohli být uraženi.
      3) Ve Walesu budou vybraní občané dostávat průměrnou mzdu v zemi. Budou si moci ponechat peníze (předpokládá se, že to bude asi 20 000 liber ročně) ke všemu, co vydělají. Pokud však nebudou chtít vykonávat žádnou práci, nebudou muset. Jedná se o absurdně štědrou verzi univerzálního základního příjmu. (Nemohu si pomoci, ale zajímalo by mě, o kolik se budou muset omezit služby pro ostatní občany, aby se tento sociální experiment zaplatil).
      4) Překvapivých 12 % postav v amerických televizních pořadech je dnes LGBT. To je samozřejmě výrazně více než dvojnásobek procenta LGBT osob žijících v Americe.
      5) Miliardáři a velké společnosti skupují tisíce akrů ve Skotsku, aby je využili pro uhlíkové kredity. Nechávají půdu zdivočet a zakazují lov, střelbu a rybolov.
      6) Ženy ve sportu by si měly příští dva nebo tři roky užívat. Nebude trvat dlouho a nikdo se dvěma chromozomy X nevyhraje žádnou sportovní soutěž. Transsexuálové z mužů na ženy brzy ovládnou veškerý ženský sport. Věřím, že je to součást Agendy 21.
      7) Vědcům se podařilo vyrobit z jaderné fúze dostatek energie na uvaření asi 60 konvic. Je z toho velké nadšení, ale tito vědci pracují na jaderné fúzi již od roku 1950. Trvalo jim tedy 72 let, než dosáhli bodu, kdy mohou uvařit trochu vody. Gratulujeme. To nás zachrání před závislostí na ropě, plynu a uhlí. Uff, jaká to bude úleva pro blázny do klimatických změn…

      1. tak já si z nudy ještě plácnu, Neukazuje to nic, co by bylo relevantní pro očkování člověka.,1970 byla objevena reverzní transkriptáza, tj. RNA->DNA.,tak že žádné velké odhalení se nekoná,jen strašení vakcínou což je u dezinformátora Fománka standart, studie byla provedena na linii nádorových buněk a je tam celá řada dalších nejasných otázek.Takovéto experimenty by se měly provádět na normálních, nikoliv nádorových buňkách. Specificky buňky Huh7 hepatocelulárního karcinomu použité v této studii se vyznačují vysokou aktivitou endogenní L1 reverzní transkriptázy.Obecně se má za to, že in vivo buňky reverzní transkriptázu neexprimují. Nicméně je to k pozornosti. Na druhou stranu, pokud se tam nakopčí vakcína, nakopčí se tam i virus což je horší,Stále si trvám že Formánek šíří dezinformace a uplné nesmyly a ti co mu věří jsou jen banda debilů, více zde https://www.science.org/content/blog-post/integration-human-genome jo a ted si taky „zapřemýšlím jako vy“ za Big Reset může Rusko,to Rusko se domluvilo s přátelenou Čínou at vypustí virus díky kterému se oslabí západ a mezitím si Rusko utvoří rezervy k utoku,u6 Rusko chrastí jadernou zbraní a chystá se vyresetovat svět.tak že není to žádný velký plán Američanů ale Big reset je plán Rusů

        1. Doporučuji vrátit se plácat zpět na seznam, idnes, zapněte si TV …a přestaňte tady otravovat. Hned budete vidět zase modré nebe a barevnou duhu 🙂
          Naučte se český jazyk, protože už kdysi jsem se snažil něco od vás přečíst a nejde to.. Ani teď nevím, co tady zase blábolíte. Nikoho to tady nezajímá. Přeskakuju vás a ignoruju 😀
          A pořád jsem nepochopil, proč sem chodíte. Nás ty mediální hovinka a vaše rozumy nezajímají. Opravdu přestaňte marnit tady čas.

          A zapněte konečně mozek:
          Všechny státy jsou divadlem. Všechny války jsou vykonstruované… není důvod, aby kdokoliv bojoval s kýmkoliv. A politika nic nevyřeší, nic z toho, na co se zaměřujeme, nic nevyřeší. Veškerá politika je pouze divadlo.. Vše je divadlo, které nás má pouze rozptýlit. Velký bratr už začal rozhodovat, co jeho občané mohou číst, kdy se nenačtou některé stránky, které nejdou ruku k ruce jednotné verzi pravdy.

          „doufám že vás taky brzy vypnou,“ = vypovídá to o vaši naprosté hlouposti a nepochopení souvislostí..

          Ministerstvo pravdy chce rozhodovat, jaké informace se nesmí číst a jaké můžeme.
          Jiné informace, než ty z hlavních zpráv (TV, seznam, rádia, centrum, idnes…), kdy úkolem médií není pravdivé informování o událostech, ale modelování a formování pravdy, už přestávají existovat.. Pravda začíná být potlačována a válka v Ukrajině je jen záminka, ale je to přece pro „naše dobro“.
          To co se teď děje na Ukrajině, ať se to někomu líbí a nebo nelíbí, nikterak nevybočuje z jiných konfliktů, co na světě probíhají prakticky každý den!!

          A pandemický zákon je schválen, odvádí se pozornost od začínající totalitní kontroly obyvatel a lidi jsou stále slepí a spí, probudí se, až bude pozdě. Starý svět který jsme znali, už přestává existovat..ORWELL CITY začíná, tak jak už bylo předpovězeno před více jak dvěma lety, stejně tak jako vše, co bylo na alternativě.

        2. Takže když je „nevyléčíme“ „vakcínou“, tak je rovnou zabijeme neposkytnutím zdravotní péče…
          Pletu se ????

        3. Vy jste opravdu neskutečný.Až vám po slavné tečce zemře či ochrne či onemocní tolik kamarádů a známých jako mně,možná změníte názor.Debilem se necítím,jsem zdravotní sestra a moji známí jsou docenti,lékaři,vědci ovšemže s opačným názorem,jak máte vy.Nikdo z farmaceutů jim totiž neplatí.Jděte si plácat svoje moudra na Desinformátory.Přesně tam se hodíte.

      2. Souhlasím s Vámi, roman asi nemá knihu BigReset. A nevidí mluvit jeho autora. Jak se říká – sám si nevidí na špičku nosu. Davida F. jen pomlouvá, na to mu málokdo skočí – z nás, kteří to vše dění sledují od začátku.

      3. konspirační teorii VR mám pročtenou,a můžu s klidným svědomím prohlásit že je to nesmysl, Velký reset jakási forma nadvlády a Nového světového řádu. Velký reset je podle teorie určený ke zničení toho světa a právě covidová krize podle něj slouží k tomu, aby mohly vlády naše práva omezit. a co je to tedy ten Velký RESET?

        JIž od roku 1971 se každoročně pořádá ekonomické fórum, na kterém se řeší nejdůležitější ekonomické otázky. Když pak přijde na řadu rok 2020 a ve světě naplno probíhá pandemie „nejmenovaného“ viru, který působí rozsáhlé ekonomické škody, dává smysl, že by tématem takového fóra měla být právě tato událost.

        A přesně tak tomu i bylo. Tématem ekonomického fóra pro rok 2020 byla právě probíhající všudypřítomná pandemie viru SARS-CoV-2 a škody na světové ekonomice, které zapříčinila. Je tedy zcela logické, že v rámci takového fóra se budete snažit přijít a vymyslet způsoby, jak tyto škody napravit a jak minimalizovat riziko, že by k takovým škodám došlo i v budoucnosti, pokud by se někdy stalo něco podobného.

        Navzdory častým mylným předpokladům, NEJEDNALO se o tajnou konferenci.

        Všechny informace jsou veřejně dostupné, včetně videozáznamů z konferencí [1], [2], [3] a i včetně samotné knihy vydané K. Schwabem, předním evropským ekonomem.

        Již po zběžném pročtení pochopíme, že jakékoliv konspirace, které se okolo tohoto točí, nejsou stavěné na základech reality.

    2. to Roman
      hurrá konečně že jste došel, kolik vás platí Vrábel na hodinu? :-)))

  1. Ďakujem za uverejnený článok, Informácie sú overené, preto chápem, že prijímatelia produktu od firmy Pfizer budú fakty prijímať agresívne.

    Užitočné pre mňa boli aj tieto relevantné informácie uvedené v originálnom článku:

    Financovanie

    Túto štúdiu podporila Švédska rada pre výskum, Strategic Research Area Exodiab, Dnr 2009-1039, Švédsky vládny fond pre klinický výskum (ALF) a nadácia Univerzitnej nemocnice Skåne.

    Doplnkové materiály

    Nasledujúce podporné informácie si môžete stiahnuť na: https://www.mdpi.com/article/10.3390/cimb44030073/s1.
    Autorské príspevky

    M.A., F.O.F., D.Y., M.B. a C.L. uskutočnené in vitro experimenty. M.A. a F.O.F. vykonal analýzu údajov. M.R. a Y.D.M. prispel k realizácii výskumu, navrhol a dohliadal na štúdiu. Y.D.M. napísal príspevok s príspevkami od všetkých autorov. Všetci autori si prečítali publikovanú verziu rukopisu a súhlasili s ňou. (V originál. článku sú samozrejme uvedené celé mená autorov)

  2. Chtěla bych upozornit na chybku v překladu. Jedno slovo, ale velice podstatné.

    Věta „(6) se shoduje s tím, že chudí lidé jsou >posedlínahraditelní< UI (umělou inteligencí) a robotikou, …".

    1. Tak ještě jednou, neboť došlo nejspiše k pokusu o nahrazení HTML tagů v rámci zabezpečení stránky.

      Věta „(6) se shoduje s tím, že chudí lidé jsou -posedlí- UI (umělou inteligencí) a robotikou, …“.
      by měla být nahrazena větou „(6) se shoduje s tím, že chudí lidé jsou -nahraditelní- UI (umělou inteligencí) a robotikou, …“.

  3. tak já si z nudy ještě plácnu, Neukazuje to nic, co by bylo relevantní pro očkování člověka.,1970 byla objevena reverzní transkriptáza, tj. RNA->DNA.,tak že žádné velké odhalení se nekoná,jen strašení vakcínou což je u dezinformátora Fománka standart, studie byla provedena na linii nádorových buněk a je tam celá řada dalších nejasných otázek.Takovéto experimenty by se měly provádět na normálních, nikoliv nádorových buňkách. Specificky buňky Huh7 hepatocelulárního karcinomu použité v této studii se vyznačují vysokou aktivitou endogenní L1 reverzní transkriptázy.Obecně se má za to, že in vivo buňky reverzní transkriptázu neexprimují. Nicméně je to k pozornosti. Na druhou stranu, pokud se tam nakopčí vakcína, nakopčí se tam i virus což je horší,Stále si trvám že Formánek šíří dezinformace a uplné nesmyly a ti co mu věří jsou jen banda debilů, K tématu víc např. zde https://www.science.org/content/blog-post/integration-human-genome

  4. tak já si z nudy ještě plácnu, Neukazuje to nic, co by bylo relevantní pro očkování člověka.,1970 byla objevena reverzní transkriptáza, tj. RNA->DNA.,tak že žádné velké odhalení se nekoná,jen strašení vakcínou což je u dezinformátora Fománka standart, studie byla provedena na linii nádorových buněk a je tam celá řada dalších nejasných otázek.Takovéto experimenty by se měly provádět na normálních, nikoliv nádorových buňkách. Specificky buňky Huh7 hepatocelulárního karcinomu použité v této studii se vyznačují vysokou aktivitou endogenní L1 reverzní transkriptázy.Obecně se má za to, že in vivo buňky reverzní transkriptázu neexprimují. Nicméně je to k pozornosti. Na druhou stranu, pokud se tam nakopčí vakcína, nakopčí se tam i virus což je horší,Stále si trvám že Formánek šíří dezinformace a uplné nesmyly a ti co mu věří jsou jen banda debilů.

  5. Bezprecedentní počet úmrtí v USA stále stoupá:
    https://media.mercola.com/ImageServer/Public/2022/March/PDF/us-excess-deaths-pdf.pdf

    „Od vypuknutí pandemie COVID-19 bylo zaznamenáno více než 1 milion nadměrných úmrtí.
    podle údajů zveřejněných americkým Centrem pro kontrolu nemocí (U.S. Centers for Disease) před téměř dvěma lety.
    Control and Prevention. Všechna tato úmrtí však nejsou způsobena COVID-19, protože vyšší
    vyšší počet úmrtí na srdeční choroby, vysoký krevní tlak, demenci a další onemocnění, která mohou způsobit vyšší riziko úmrtí.
    onemocnění se během pandemie vyskytly. Od pandemie COVID-19 bylo zaznamenáno více než 1 milion nadměrných úmrtí.
    Bývalý portfolio manažer společnosti BlackRock Edward Dowd zdokumentoval nárůst úmrtnosti
    mezi mladšími osobami v produktivním věku, který se shodoval s povinným očkováním.“

    1. To má být vtip? víte kdo je Joseph Michael Mercola?? je americký zastánce alternativní medicíny, osteopatický lékař a osobnost internetového obchodu. Prodává doplňky stravy a zdravotnické prostředky. [2] Na svých webových stránkách Mercola a kolegové obhajují neprokázané a pseudovědecké alternativní zdravotní pojmy včetně homeopatie a opozice vůči očkování. Tyto postoje se setkaly s vytrvalou kritikou. [3] Mercola je členem několika organizací alternativní medicíny, stejně jako politické advokační skupiny Association of American Physicians and Surgeons, která propaguje vědecky zdiskreditované názory na medicínu a nemoci,tvrzení společnosti Mercola byla kritizována lékařskou, vědeckou, regulační a obchodní komunitou. Úvodník BusinessWeek z roku 2006 uvedl, že jeho marketingové praktiky se spoléhaly na „úhlednou propagaci, chytré využívání informací a taktiku zastrašování“. [6] V letech 2005, 2006 a 2011 americký Úřad pro kontrolu potravin a léčiv (FDA) varoval Mercolu a jeho společnost, že činí nezákonné tvrzení o schopnosti svých produktů detekovat, předcházet a léčit nemoci. [8] Quackwatch kritizoval Mercolu za to, že učinila „nepodložená tvrzení, [která] jsou v rozporu s tvrzeními předních lékařských a zdravotnických organizací a mnoha nepodloženými doporučeními pro doplňky stravy“. [9][10] O marketingových technikách společnosti Mercola chirurgický onkolog David Gorski říká, že „míchá nudné, rozumné zdravotní rady s pseudovědeckými radami takovým způsobem, že je pro někoho bez lékařského zázemí těžké zjistit, která je která.“ [3]

      Během pandemie COVID-19 společnost Mercola šířila dezinformace o viru a pseudovědecké dezinformace proti očkování na platformách sociálních médií; [11][12][13] výzkumníci ho identifikovali jako „hlavního šiřitele dezinformací o koronaviru online“. [11][14][15][16] Byl při mnoha příležitostech varován FDA za prodej neschválených zdravotnických produktů, včetně předpokládané léčby COVID-19. [15] Mercola byla zakázána Youtube za pseudovědecká a lživá tvzení,, jeho analíza o milionu mrtvých je tak jedna velké fraška. o tom jaký je Mercola protiočkovacíblb si mužete přečíst zde na Wiki https://en.wikipedia.org/wiki/Joseph_Mercola očekávám že Wiki zpochybníte,ale když sjedete lištu dolů, máte tam vše odzdrojované.

      1. = Vraťte se zpět k té vaší mediální žumpě typu seznam, tv apod., vy ověřovači dezinformací 😀 xD plácáte tady a oháníte se jedinou propagandou, tedy ehmm, jedninou pravdou a „fakty“, jste k smíchu !! A vraťte se za Cemperem a přestaňte už tady otravovat…nikoho ty vaše výlevy z TV/Seznam/Cempera/Ministerstva pravdy nezajímají —

  6. Ty máš chlapečku obrácené myšlení a zřejmě vůbec nechápeš oč v tomto světě a této době jde. Američani jsou na dně, ne-li hůř, oni dluží všem státům na této planetě, oni potřebují zlikvidovat celoplanetární ekonomiku, žádný jiný stát ani kontinent se nesere do státních systémů jiných zemí, Američani strkají rypáky všude na planetě. Oni jsou rozpínaví jako atomová bomba. O to, aby šla celosvětová ekonomika na hubu, Američtí sráči bojují už desítky let a protože jim to nevychází, zvolili vylidnění planety jedem. Když ti ty sračky, který oni od Pfizeru nabízejí tak imponují, choď se nechat opíchat i 10 x denně a nebo si s těmi, kteří tuhle šmakuládu nabízejí, připíjej tím sajrajtem na zdraví, ale dnes už je téměř dokázáno, že ti, kteří se nechali zblbnout a nechali se opíchat, jsou de-facto chodící mrtvoly, Bohužel pro ně a nikdo jim to nepřeje, závidět není co. To že se Američani nasrali k Ukrajině, tak jenom proto, že Ukrajina má ještě docela dost přírodního bohatství a protože Američani svůj kontinet zruinovali, potřebují někde získat pro sebe hodnotný materiál. Ty evidentně žiješ někde v sudu a papouškuješ informace dezinformátorů. Lehni na bok a spi dál.

  7. Vyhlazovací zápletka: Kovid injekce bílkovin s hroty mRNA potlačí opravu DNA! Po níž následují globální jaderné události, které uvolní záření poškozující DNA…

    „Najednou je jejich strategie naprosto jasná. Injekce mRNA s proteinem spike způsobují zhruba 90% potlačení mechanismu opravy DNA známého jako NHEJ – Non-Homologous End-Joining. Jedná se o buněčný mechanismus, který existuje v buňkách lidí, zvířat a rostlin, aby udržoval genetickou integritu – nezbytnou podmínku života.

    Díky mechanismu NHEJ jsme schopni automaticky opravovat dvouřetězcové zlomy (DSB) v našich chromozomech, když jsme vystaveni ionizujícímu záření. Mezi běžné zdroje ionizujícího záření patří sluneční záření, lety dopravními letadly a mamografy. Když náš motor NHEJ funguje normálně, chromozomy poškozené ionizujícím zářením jsou opraveny a nestávají se z nich rakovinné nádory. Když je však NHEJ potlačena, tělo nedokáže opravit poškození DNA a začnou růst mikronádory.“

    Více informací zde: https://www.naturalnews.com/2022-03-04-binary-weapon-extermination-plot-mrna-spike-protein-injections-ionizing-radiation.html

  8. Další konspirační žumpa,co čekat autorem je známý antivaxer Mike Adams, Na úvod je nutné napsat, že web Natural News je považován za konspirační web šířící falešné zprávy mj. o očkování a blížící se apokalypse , https://weather.com/science/video/fake-news-empire-exposed . Na sociální síti Facebook koluje konspirační video, které cituje Mikea Adamse, který měl před lety varovat před pandemií a masivní očkovací kampaní. V roce 2017 dokonce společnost Google, kvůli neustálému šíření falešných zpráv, zablokovala jeho projekt ve svém vyhledávači a na platformě YouTube, ze stejného důvodu společnost Facebook odstranila i stránku na její stejnojmenné sociální síti. Různé organizace pro kontrolu faktů opakovaně označily obsah Natural News za nepravdivý.https://www.politifact.com/factchecks/list/?speaker=naturalnewscom

    V úvodu videa zaznívá, že autor citovaný jako Mike Adams (známý také jako Michael Allen nebo Health Ranger) z Natural News je vědec. Ve skutečnosti však není známo, že by měl jakékoliv vysokoškolské vzdělání a obecně je představován jako publicista.

    Ve videu se hovoří o tom, že virus SARS-CoV-2 byl uměle vytvořen. K tomu neexistují důkazy a vědci naopak se přiklání k přirozenému původu viru. Video dále zmiňuje zákon SB 277 z Kalifornie, který byl přijat po vypuknutí epidemie spalniček. Zákon nebyl zákonem o povinném očkování, ale o zákazu vstupu neočkovaných osob do škol a denních stacionářů. Výjimku však měli například lidé odmítající očkování na základě své víry.

    Video následně obsahuje smyšlený scénář očkování. Není dokázáno, že by očkování proti nemoci COVID-19 bylo jakkoliv nebezpečné. Byla zveřejněna například data z trialu BioNTech/Pfizer. Ze studie https://www.fda.gov/media/144245/download?fbclid=IwAR1fzfxIvVBduNhE-tCbGxbTr86CBHHaicszrGzfj3dSB121LYpTNbypync vyplývá, že byl pozorován podobný počet nežádoucích účinků u lidí, kterým byla podána vakcína a u lidí, kterým bylo podáno placebo.

    V České republice bude očkování nepovinné. Co se týká očkování, je známo, že očkovaní lidé budou mít snadnější možnost cestovat. Nikde však není uvedeno, že by neočkovaným osobám bylo zakázáno cestovat.

    Následně video obsahuje již jen konspirační teorie například o časových spínačích ve vakcínách,, pane KOTAS věříte na neskutečné bludy a dezinfo scéna vás semlela 🙂

    1. „konspirační žumpa,co čekat autorem je známý antivaxer “ po přečtení této začáteční věty jsem musel přestat, vy se běžte léčit 😀

  9. Dobrý den, pane Romane. Vy patříte přesně do skupiny lidí, kteří jsou tak důležití pro vládnoucí elitu. Díky takovým lidem, jako jste Vy, vznikají totalitní, případně diktátorské režimy. Mělo by Vám být divné, a měl byste se i zlobit, že nejsou připuštěni do veřejných sdělovacích prostředků i odborníci, kteří mají za sebou velmi ceněné odborné práce. Těchto odborníků je mnoho, patří k nim i nositelé Nobelovy ceny, případně jiných světových ocenění. Celá tato divadelní taškařice, která je nám předváděna k v souvislosti s „Covidem“, která doslova hýří logickými nesmysli, musí nalomit i žáčka z obecné školy. A jak je to s politiky a s oficiálními sdělovacími prostředky? To musí být také každému, kdo má zbytky mozku, jasné. Chce se, abychom byli poslušní a tleskali vládě, parlamentu a jediným správným šiřitelům té jedině pravdy. A proč to dělají? To je přece také úplně jasné. Stačí se podívat, kam tečou peníze za nesmyslné testy (které neukazují ale vůbec nic, natož potom klinický obraz), a škodící „vakciny“, které vakcinami vůbec nejsou, neboť nezamezují přenosu, ani Vás nechrání před nákazou. Navíc velice škodí, a to známe jenom zlomek škodlivých účinků.
    Vše hrozné se projeví až po několika letech, případně v další generaci lidí. A potom takoví lidé, jako jste Vy, pane Romane, budou říkat, že za nic nemohou. Já mám zásadu, MOJE TĚLO, MOJE PRAVIDLA, a jenom já vím, co je pro mne dobré. –
    A rozhodně mi nebude nějaký „pseudoexpert“ či politik nařizovat i šikanovat mě, že nechci tuto škodlivou injekci do sebe naládovat, protože vím, že je ve finále škodlivější než samotná choroba. A to je mi 75 let, jsem aktivní, starám se o svoji imunitu, sportuji, ještě pracuji, chodím (i v uplynulých příšerných dvou letech) mezi lidi, jezdím veřejnou dopravou , sportuji a HLAVNĚ se nenechávám zastrašovat propagandou. Prostě a jednoduše jim nevěřím, neboť vše, co propagují, postrádá logiku a slouží to jenom farmakomafianským elitám za výborného přispění vlád, a také za přispění lidí, jako jste Vy.
    Přeji Vám hodně zdraví a ještě více zamyšlení. –
    Věra

Napsat komentář

Vaše e-mailová adresa nebude zveřejněna.

Odebírejte novinky přímo na email

+ Získáte odkaz ke stažení všech videí. Odhlásit se můžete kdykoliv. Ochrana osobních údajů

Odebírejte novinky přímo na email

+ Získáte odkaz ke stažení všech videí. Odhlásit se můžete kdykoliv. Ochrana osobních údajů

Odebírejte novinky přímo na email

+ Získáte odkaz ke stažení všech videí. Odhlásit se můžete kdykoliv. Ochrana osobních údajů